View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_low_23 (Length: 261)
Name: NF10950_low_23
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 243
Target Start/End: Complemental strand, 39488855 - 39488617
Alignment:
| Q |
5 |
ttgactacattagcagcatccatctcaatcaccacattttggaggttttgagtctttacccattgcaggcaccatctcaatcccaacgcctcagccagat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39488855 |
ttgactacattagcagcatccatctcaatcaccacattttggaggttttgagtctttacccattgcaggcaccatctcaatcccaacgcctcagccatat |
39488756 |
T |
 |
| Q |
105 |
ttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatggtccctacttattaaaccccaacacgtgtagttatctttaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39488755 |
ttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatggtccctactgattaaaccccaacaagtgtagttatctttaaa |
39488656 |
T |
 |
| Q |
205 |
acagccagcatcaatgttcaccttaacaaaacccgcttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39488655 |
acagccagcatcaatgttcaccttaacagaacccgcttg |
39488617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 46034981 - 46034739
Alignment:
| Q |
1 |
acagttgactacattagcagcatccatctcaatcaccacattttggaggttttgagtctttacccattgcaggcaccatctcaatcccaacgcctcagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46034981 |
acagttgactacattagcagcatccatctcaatcaccacattttggaggttttgagtctttacccattgcaggcaccatctcaaacccaacgcctcagcc |
46034882 |
T |
 |
| Q |
101 |
agatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatggtccctacttattaaaccccaacacgtgtagttatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
46034881 |
agatttggggaacatgtgatcctctcgctcttggtggctgcaacttgtacgacaccttcatggtccctactgattaaaccccaacaagtgtagttatctt |
46034782 |
T |
 |
| Q |
201 |
taaaacagccagcatcaatgttcaccttaacaaaacccgcttg |
243 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
46034781 |
taaaacagccagcatcaatgtccaccttaacagaacccgcttg |
46034739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University