View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_low_27 (Length: 248)
Name: NF10950_low_27
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 4487426 - 4487196
Alignment:
| Q |
1 |
cacatgaaccactttcgttagaccccaatggtccatatcaatctcaaacttccttacaattttgatgcgaaataaaattatgcaaaacagacaaacctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487426 |
cacatgaaccactttcgttagaccccaatggtccatatcaatctcaaacttccttacagttttgatgcgaaataaaattatgcaaaacagacaaacctgt |
4487327 |
T |
 |
| Q |
101 |
tacagaaagctcctaatttgaaacattgaatttgaactcatctaatgtctatgattttattttgcaggggcagaaatgtacagcaacttaactcgagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4487326 |
tacagaaagctcctaatttgaaacattgaatttgaactcatctaatgtctatgattttattttgcaggggcagaaatgcacagcaacttaactcgagttg |
4487227 |
T |
 |
| Q |
201 |
tgatggtctcatggctctttcttgtattgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4487226 |
tgatggtctcatggctctttcttgtattgat |
4487196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 4482352 - 4482301
Alignment:
| Q |
180 |
acagcaacttaactcgagttgtgatggtctcatggctctttcttgtattgat |
231 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4482352 |
acagcagcttaactcgagtggtgatggtctcatggctctttcttgtattgat |
4482301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University