View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_low_34 (Length: 238)
Name: NF10950_low_34
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 28551022 - 28551233
Alignment:
| Q |
17 |
ggtgatgtccttaaacaatgatgtctgaagaaaacgggccagtgtttaagaaccaaaagataggacttttttcaaaattagacattagataaatgaat-- |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28551022 |
ggtgatgtccttaaacaatgatgtctgaagaaaacgggccagtgtttaagaaccaaaagagaggacttttctcaaaattagacattagataaatgaattc |
28551121 |
T |
 |
| Q |
115 |
--catctcttttataaattcaacattttactattcataaacaatg-aaacgaaacaagtttcttctcaagtgagagcttccaccttatatacttgatcca |
211 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28551122 |
aaaattagacatataaattcaacattttactattcataaacaatgaaaacgaaacaagtttcttctcaagtgagagcttccacctcatatacttgatcca |
28551221 |
T |
 |
| Q |
212 |
tatgtcaagatt |
223 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
28551222 |
tatgccaagatt |
28551233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 143
Target Start/End: Original strand, 12035639 - 12035671
Alignment:
| Q |
111 |
gaatcatctcttttataaattcaacattttact |
143 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
12035639 |
gaatcatatcttttataaattcaacattttact |
12035671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University