View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10950_low_39 (Length: 217)
Name: NF10950_low_39
Description: NF10950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10950_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 34526209 - 34526026
Alignment:
| Q |
15 |
agaaaaaatgttatcaaacaggtcttttttgtcgcatgatcttataagctataagctcaacagagtcttagttgtttggtttcatggtctggtttgttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34526209 |
agaaaaaatgttatcaaacaggtcttttttgtcgcatgatcttataagctataagctcaacagagtgttagttgtttggtttcatggtctggtttgttaa |
34526110 |
T |
 |
| Q |
115 |
agtaagatgtagtagtaggattttgtcataggttgaaattgaagttttgcggtaatgatatgaaccttaatacactataacact |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34526109 |
agtaagatgtagcagtaggattttgtcataggttgaaattgaaattttgcggtaatgatatgaaccttaatacactataacact |
34526026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 74
Target Start/End: Complemental strand, 31677148 - 31677101
Alignment:
| Q |
27 |
atcaaacaggtcttttttgtcgcatgatcttataagctataagctcaa |
74 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
31677148 |
atcaaacaggtcttttttgtcaaattagcttataagctataagctcaa |
31677101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University