View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10951_high_20 (Length: 236)
Name: NF10951_high_20
Description: NF10951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10951_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 56 - 225
Target Start/End: Complemental strand, 10843231 - 10843061
Alignment:
| Q |
56 |
ttgttctctgaaatttcatgtccacatagatgttgaagaacttgtttttattgttttggattctttccttc-acgaaatcgttttcgtttgaggatttta |
154 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10843231 |
ttgttctctgagatttcatgtccacatagatgttgaagaacttgtttttattgttttggattctttccttcgacgaaatcgttttcgtttgaggatttta |
10843132 |
T |
 |
| Q |
155 |
attatgaattattatgtggatgtatattgaaggtgaagtatacttatcactgtcaatgcctctttcttgtg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10843131 |
attatgaattattatgtggatgtatattgaaggtgaagtatacttatcactgtcaatgcctctttcttgtg |
10843061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University