View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10951_low_19 (Length: 278)
Name: NF10951_low_19
Description: NF10951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10951_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 269
Target Start/End: Complemental strand, 46102377 - 46102127
Alignment:
| Q |
19 |
gatgatgctgtgtctttagaggtgtgctgtatataggtttaatttcagcnnnnnnncagaacctcggaccttgtggaagcggttttgcaggggaggaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46102377 |
gatgatgctgtgtctttagaggtgtgttgtatataggtttaatttcagctttttttcagaacctcggaccttgtggaagcggttttgcaggggaggaatg |
46102278 |
T |
|
| Q |
119 |
ggtcggttttctgttatggtgcaacgggagctggaaaaacctatacaatgcttggtactgtggagaatccaggggtgatggttttggctattaaggatct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46102277 |
ggtcggttttctgttatggtgcaacgggagctggaaaaacctatacaatgcttggtactgtggagaatccaggggtgatggttttggctattaaggatct |
46102178 |
T |
|
| Q |
219 |
ttttggtaaaatcaggcagagaagctgtgatggaagccatgtggttcatct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46102177 |
ttttggtaaaatcaggcagagaagctgtgatggaagccatgtggttcatct |
46102127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 75 - 269
Target Start/End: Original strand, 23976283 - 23976477
Alignment:
| Q |
75 |
cagaacctcggaccttgtggaagcggttttgcaggggaggaatgggtcggttttctgttatggtgcaacgggagctggaaaaacctatacaatgcttggt |
174 |
Q |
| |
|
||||||||| || || |||||| | ||| |||| |||| ||||||| | ||||||||||||||||| || |||||||||||||| || |||||||||||| |
|
|
| T |
23976283 |
cagaacctcagaactcgtggaatcagttctgcaagggaagaatgggacagttttctgttatggtgccaccggagctggaaaaacttacacaatgcttggt |
23976382 |
T |
|
| Q |
175 |
actgtggagaatccaggggtgatggttttggctattaaggatctttttggtaaaatcaggcagagaagctgtgatggaagccatgtggttcatct |
269 |
Q |
| |
|
|| ||||| | || || |||||||| ||||| ||||||||||| || ||||||||||| |||||| |||||||| | |||||| |||||||| |
|
|
| T |
23976383 |
acagtggaaagcccgggagtgatggtgttggcaattaaggatctcttcagtaaaatcaggacgagaagttgtgatgggaaccatgttgttcatct |
23976477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University