View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10952_high_6 (Length: 321)
Name: NF10952_high_6
Description: NF10952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10952_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 13 - 303
Target Start/End: Complemental strand, 44581564 - 44581271
Alignment:
| Q |
13 |
gagatgaacatgtgcaccaactaattagccaagtttgaaataaggtctattagtgatttgtcgactgtgtttgatccctcgattgagcttcacttgttgc |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44581564 |
gagatgaacatgtgcgccaactaattagccaagtttgaaataaggtctattagttatttatcgactgtgtttgatccctcgattgagcttcacttgttgc |
44581465 |
T |
 |
| Q |
113 |
ttaagatagacagtggcggaatatggtggatgcggtcaatagcggtggcggagccgccactcccactcatgggcataggtg---gtgggtacacttgaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44581464 |
ttaagatagacagtggcggaatatggtggatgcggtcaatagcagtggcggagccgccactcccactcatgggcataggtggtggtgggtacacttgaag |
44581365 |
T |
 |
| Q |
210 |
atgtgtttgcgatttcaatatatttagagattatgatgaaaatatttcatgtattgagggaagaaaataagaggtaatcttgtttggactcatg |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
44581364 |
atgtgtttgcaatttcaatatatttagagactatgatgaaaatatttcatgtattgagggaacaaaataggagataatcttgtttggactcatg |
44581271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University