View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10952_low_13 (Length: 236)
Name: NF10952_low_13
Description: NF10952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10952_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 16534765 - 16534561
Alignment:
| Q |
15 |
agatgaagaaaaggaatctcttgttgattggggaatcgaagatgggtcgcacatttaccttttctttaatcctattgatgatgagtctacaaaacattgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16534765 |
agatgaagaaaaggaatctcttgttgattggggaatcgaagatgggtcgcacatttaccttttctttaatcctattgatggtgagtctacaaaacattgt |
16534666 |
T |
|
| Q |
115 |
gtgtttaatctacctaatcttcttcttggttagaaatgtcatcgcgcgtcgaaccatgatctatggttaatgtattgtttagcagttgtagagaccgtta |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16534665 |
gtgtttaatctacctgatcttcttcttggttagaaatgccatcgcgcatcgaaccatgatctatggttaatgtattgtttagcagttgtagagaccgtta |
16534566 |
T |
|
| Q |
215 |
gattt |
219 |
Q |
| |
|
||||| |
|
|
| T |
16534565 |
gattt |
16534561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University