View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10952_low_15 (Length: 216)
Name: NF10952_low_15
Description: NF10952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10952_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 36164149 - 36163957
Alignment:
| Q |
13 |
catagggccaaactgctagtggttgagccacaaaaatgagttatatat------tcctcccatgcagtataattgcaatttgcagtcggcacatgcctaa |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36164149 |
catagggccaacctgctagtggttgagccacaaaaatgagttatatatatatattgctcccatgcagtataattgcaatttgcagtctgcacatgcctaa |
36164050 |
T |
|
| Q |
107 |
attcaggggtcagcatccagtatatcttgcatgtatatcactcaataatgagaagcaatgtaggataatttgaagcaatgtttgtattcctaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36164049 |
attcaggggtcagcatccagtatatcttgcatgtatatcactcaataatgagaagcaatgtaggataatttgaagcaatgtttgtattcctaa |
36163957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 134
Target Start/End: Complemental strand, 32235547 - 32235501
Alignment:
| Q |
88 |
gcagtcggcacatgcctaaattcaggggtcagcatccagtatatctt |
134 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
32235547 |
gcagtctgcacatgactcaattcaggggtcagcatccagtatatctt |
32235501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University