View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10953_high_10 (Length: 311)
Name: NF10953_high_10
Description: NF10953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10953_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 7 - 296
Target Start/End: Original strand, 26776033 - 26776322
Alignment:
| Q |
7 |
ggagcagagagcagaataaattgtttgaatatgcattggccaattagcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaa |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776033 |
ggagcagcgagcagaataaattgtttgaatatgcattggccaattatcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaa |
26776132 |
T |
 |
| Q |
107 |
atctttggaacaaattaaacatcactatgaggttttgatagatgatatccacaacattgaatctggttttgtgcctccaccagattatgattctttttca |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26776133 |
aactttggaacaaattaaacatcactatgaggttttggtagatgatattcacaacattgaatctggttttgtgcctctaccagattatgattctttttca |
26776232 |
T |
 |
| Q |
207 |
aactcaacaaagtgtactattgtcaaaaagggaattaaggcttccggttcttatcattggacagaagatgaacacaggtctgtttatctt |
296 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776233 |
aactcaacaaagtgtactattgttaaaaagggaactaaggcttccggttcttatcattggacagaagatgaacacaggtctgtttatctt |
26776322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 30 - 208
Target Start/End: Complemental strand, 26556619 - 26556441
Alignment:
| Q |
30 |
tttgaatatgcattggccaattagcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaatctttggaacaaattaaacatc |
129 |
Q |
| |
|
|||||| || ||||||| ||||| || || || | |||||||||||||||||| |||||||| | |||||| |||||| |||| ||| | ||||||| || |
|
|
| T |
26556619 |
tttgaaaatacattggcgaattatcccgaggacgctgtggatcgatgggagaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtc |
26556520 |
T |
 |
| Q |
130 |
actatgaggttttgatagatgatatccacaacattgaatctggttttgtgcctccaccagattatgattctttttcaaa |
208 |
Q |
| |
|
|||||| ||||||| | ||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26556519 |
actatgtggttttgtttgatgatatcaaccacattgaatctggttttgtgcctctgccagattatgattctttttcaaa |
26556441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University