View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10953_high_16 (Length: 219)
Name: NF10953_high_16
Description: NF10953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10953_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 25710386 - 25710205
Alignment:
| Q |
21 |
atgaatcatctttactgtttaccagaaacaaatggctgagtcgatcttgaatctcaaatagtccatattcaatatatttgtaggcgtggttgccaagaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25710386 |
atgaatcatctttactgtttaccagaaacaaatggctgagtcgatcttgaatctcaaatagtccatattcaatatatttgtaggcgtggttgccaagaaa |
25710287 |
T |
|
| Q |
121 |
atcctgaaactttcccatgaagattccgtatgctggtagcaaagtgttctccacagactctattacttcttttctaagctct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25710286 |
atcctgaaactttcccatgaagattccgtatgctggtagcaaagtgttttccacagactctattacttcttttctaagctct |
25710205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University