View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10953_low_8 (Length: 387)
Name: NF10953_low_8
Description: NF10953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10953_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 286 - 373
Target Start/End: Complemental strand, 28254091 - 28254004
Alignment:
| Q |
286 |
attaacaatagaaataggctgatttcttgctttccatgtagtagtagccaacaaaatcgaattttcttttaacaagaacaacataact |
373 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28254091 |
attaacaataggaataggctgatttcttgctttccatgtagtagtagccaacaaaatcgaattttcttttaacaagaacaacataact |
28254004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 192 - 290
Target Start/End: Complemental strand, 28254668 - 28254571
Alignment:
| Q |
192 |
cagtttatatgtattaattttgtcatcaaatgggtgagaccatttcttgtnnnnnnnnnnttggtgagaatataaaatctaatgcaatgatcatattaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28254668 |
cagtttatatgtattaattttgtcatcaatatggtgagaccatttcttgtaaaaaaaaa-ttggtgagaatataaaatctaatgcaatgatcatattaa |
28254571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 85 - 128
Target Start/End: Complemental strand, 28254775 - 28254732
Alignment:
| Q |
85 |
agttttgtagcattgtgttttaatattgactatattggatgtgc |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28254775 |
agttttgtaacattgtgttttaatattgactatattggatgtgc |
28254732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University