View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_111 (Length: 357)
Name: NF10954A_low_111
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_111 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 128 - 351
Target Start/End: Original strand, 44546958 - 44547176
Alignment:
| Q |
128 |
ataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaannnnnnnnnnnnctaatagtccacattttatctttcttttatgatgtgtatgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546958 |
ataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaatttttcttttttctaatagtccacattttatctttcttttatgatgtgtatgt |
44547057 |
T |
|
| Q |
228 |
actatctattcgaatgccattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
327 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547058 |
actat----tcgaatgtcattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
44547153 |
T |
|
| Q |
328 |
caccgattgtgtgaatgtcggggg |
351 |
Q |
| |
|
||| ||||||||| |||||||||| |
|
|
| T |
44547154 |
cactgattgtgtg-atgtcggggg |
44547176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 44546843 - 44546893
Alignment:
| Q |
13 |
gaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546843 |
gaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
44546893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University