View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_133 (Length: 344)
Name: NF10954A_low_133
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_133 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 13 - 338
Target Start/End: Complemental strand, 23358533 - 23358208
Alignment:
| Q |
13 |
atactcatcctttttgtacacaaaatcgacgttgaataatggaacatgtttcaatttttgtgtagcagcgaaacgaataccattgaaaggtccacttctg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358533 |
atactcatcctttttgtacacaaaatcgacgttgaataatggaacatgttttaatttttgtgtagcagcgaaacgaataccattgaaaggtccacttctg |
23358434 |
T |
|
| Q |
113 |
tatatcatcgacgaaccattccttatctccgattcaggattgtcacttcttatgtagccataagtcgtttgacccgaagaagggtcatcccaattcttcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358433 |
tatatcatcgacgaaccattccttatctccgattcaggattgtcacttcttatgtagccataagtcgtttgacccgaagaagggtcatcccaattcttcc |
23358334 |
T |
|
| Q |
213 |
aagctgttagttgcctattaagaccgctcgtaaggttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaagta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358333 |
aagctgttagttgcctattaagaccgctcgtaaggttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaagta |
23358234 |
T |
|
| Q |
313 |
aaaaccatgatcactatggtctttct |
338 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
23358233 |
aaagccatgatcactatggtctttct |
23358208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 247 - 309
Target Start/End: Original strand, 23343525 - 23343587
Alignment:
| Q |
247 |
gttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
309 |
Q |
| |
|
|||||| ||||||||||||||||| | || ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23343525 |
gttccatccaagcttcattcctggcaaaaatgtatcacttggatagtcaaaactctgccacaa |
23343587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 247 - 309
Target Start/End: Complemental strand, 23383718 - 23383656
Alignment:
| Q |
247 |
gttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
309 |
Q |
| |
|
|||||| ||||||||||||||||| | || ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23383718 |
gttccatccaagcttcattcctggcaaaaatgtatcacttggatagtcaaaactctgccacaa |
23383656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 312
Target Start/End: Complemental strand, 31705291 - 31705238
Alignment:
| Q |
259 |
cttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaagta |
312 |
Q |
| |
|
|||||| ||||| | ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
31705291 |
cttcatccctggcaaaattgtatcacagggatagtcaaagctttgccacaagta |
31705238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University