View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_137 (Length: 340)
Name: NF10954A_low_137
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_137 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 4 - 334
Target Start/End: Original strand, 5188280 - 5188609
Alignment:
| Q |
4 |
aatatcttagagggagaccaacccattcgataacttcactattatttttctttcttcttccnnnnnnnnn-ctccactattattgttggcatctactatt |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5188280 |
aatatcttagagggagaccaacc-attcgataacttcactattatttttctttcttcttccaaaaaaaaaactccactattattgttggcatctactatt |
5188378 |
T |
|
| Q |
103 |
tgctaaaagaatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcat |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5188379 |
tgctaaaaggatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcat |
5188478 |
T |
|
| Q |
203 |
cggaatattccttgtaccnnnnnnnnncgtagctgtcattttgatgaataaaataattcatatatactgtataggaagggatttggaatctgcatcaaac |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5188479 |
cggaatattccttgtacctttttttttcgtagctgtcattttgatgaataaaataattcatatatactgtata-gaagggatttggaatctgcatcaaac |
5188577 |
T |
|
| Q |
303 |
ccttgcgtcgttgtgttgcatgatgaatgaaa |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5188578 |
ccttgcgtcgttgtgttgcatgatgaatgaaa |
5188609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University