View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_138 (Length: 339)
Name: NF10954A_low_138
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_138 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 4 - 280
Target Start/End: Original strand, 17232578 - 17232854
Alignment:
| Q |
4 |
aacatagaaacacaactagtggattaaacccaaatacatcaaagaatttacacaccaacgtttaagatcagaacctaaatttggattatttgctttcaac |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17232578 |
aacataaaaacacaactagtggattaaacccaaatacatcaaagaatttacccaccaacgtttaagatcagaacctaaatttggattgtttgctttcaac |
17232677 |
T |
|
| Q |
104 |
caccaataagataacaactttattttatcaaacacatggtcaattgaatttactttttgctggaatcaacgataatttcttttcttttagatgacccatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232678 |
caccaataagataacaactttattttatcaaacacatggtcaattgaatttactttttgctggaatcaacgataatttcttttcttttagatgacccatg |
17232777 |
T |
|
| Q |
204 |
cacaacctggccaaatagtgcaaaaataatactagattttgcttgagaaaccaccgagtgcgccaaaatatataaca |
280 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232778 |
cacaacctagccaaatagtgcaaaaataataccaaattttacttgagaaaccaccgagtgcgccaaaatatataaca |
17232854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 276 - 339
Target Start/End: Original strand, 17233054 - 17233117
Alignment:
| Q |
276 |
taacaaatgccaagcaaaaatcaatacttttaacaggacaactttgttccaagtaatattatga |
339 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17233054 |
taacaaatgccaagcaaaaatcgatacttttaacaggacaactttgttccaaataatattatga |
17233117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University