View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_142 (Length: 337)
Name: NF10954A_low_142
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_142 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 261
Target Start/End: Complemental strand, 28524503 - 28524250
Alignment:
| Q |
5 |
aatcacatgtgtccatgcctcaccaccagacacaaattcaatcagaggggtcggtaatcataccagatttgaccaatttatatataaactttatttccca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524503 |
aatcacatgtgtccatgcctcaccaccagacacaaatccaatcagaggtgtcggtaatcataccagatttgaccaatttatatataaactttatttccca |
28524404 |
T |
|
| Q |
105 |
tgtttcaatagttacttttattccttaaaataataaaatagtacgtgtgattttgttaagattatccttgtatttccaccatttctactagacatttgat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
28524403 |
tgtttcaatagttacttttattccttaaa---ataaaatagtacgtgtgattttgttaagattaaccatgtatttccaccatttctactagacatttgat |
28524307 |
T |
|
| Q |
205 |
atatgtgtagcaccgacatttctgacggaacttggaaggtgtaccggtgtcagacac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524306 |
atatgtgtagcaccgacatttctgacggaacttggaaggtgtaccggtgtcagacac |
28524250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 288 - 327
Target Start/End: Complemental strand, 28524221 - 28524182
Alignment:
| Q |
288 |
caaattcttatggttgtatcagtgtcgtcgtgttgatgtc |
327 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
28524221 |
caaattcttacggttgtatcagtgccgtcgtgttgatgtc |
28524182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University