View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_146 (Length: 335)
Name: NF10954A_low_146
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_146 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 7753083 - 7752752
Alignment:
| Q |
1 |
tcagggattgagccggttagctggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753083 |
tcagggattgagccggttaactggttttgaaatagggaaagttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaa |
7752984 |
T |
|
| Q |
101 |
tgtatatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7752983 |
tgtatatgtagagttgttctaggctcttgatcatgcctaaggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttggt |
7752884 |
T |
|
| Q |
201 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccggagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752883 |
gagtcgacctagtgatgcagggatttggccggtaaacctgttcccagagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattggg |
7752784 |
T |
|
| Q |
301 |
ccggtgagactgtccaagctaaagtcgaggtg |
332 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
7752783 |
cctgtgagactgtccaagctaaagtcgaggtg |
7752752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University