View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_156 (Length: 326)
Name: NF10954A_low_156
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_156 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 43 - 300
Target Start/End: Complemental strand, 41923226 - 41922969
Alignment:
| Q |
43 |
gcaagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaaatacccatctaacggacatcaacaaagactaatac |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41923226 |
gcaagaaccacctattttagagtttgatggacgtacgtttgtgatgatgattcaaaatttgtaaaatacccatctaacggacatcaacaaggactaatac |
41923127 |
T |
|
| Q |
143 |
ggagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgctccccgtgaatatccattgtaatctctactcttaatcctcccc |
242 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41923126 |
gaagttgacaataatatcaattttatttcataagtgagtagccgatgaatactttgcttcccgtgaatatccattgtaatctctactcttaattctcccc |
41923027 |
T |
|
| Q |
243 |
gtctccatccctgtcattcttcaacttgttctctctgaaatgagacatctctctctct |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923026 |
gtctccatccctgtcatttttcaacttgttctctctgaaatgagacatctctctctct |
41922969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University