View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_159 (Length: 325)
Name: NF10954A_low_159
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_159 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 38815050 - 38815356
Alignment:
| Q |
19 |
tgcagttcatagaatttgggttggtctaattcaacactacaaaatcaacttgacttgtaagatgatgactactcaaatttattagtacnnnnnnnnggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38815050 |
tgcagttcatagaatttgggttggtctaattcaacactacaaaatcaacttgacttgtaagatgatgactactcaaatttattagtacttttttttggtt |
38815149 |
T |
|
| Q |
119 |
gaaaaaacttgatctaaaacacaagacgtatccggtgggaaaaaaggttacaaccacactgcctatacagagcataggtaacataacacctaaacagaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815150 |
gaaaaaacttgatctaaaacacaagacgtatccggtggcaaaaaaggttacaaccacactgcctatacagagcataggtaacataacacctaaacagaaa |
38815249 |
T |
|
| Q |
219 |
accccaacttaaaagagagaattaattaaccactcctcaaacaaaagaaatagacgctctctcctaacacataaccaagctatgctcaccaaacaatcca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38815250 |
accccaacttaaaagagagaattaattaaccactcctcaaacaaaagaaatagacgctctctcctaacacataaccaagctaggctcaccaaacaatcca |
38815349 |
T |
|
| Q |
319 |
caggaag |
325 |
Q |
| |
|
||||||| |
|
|
| T |
38815350 |
caggaag |
38815356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University