View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_213 (Length: 295)
Name: NF10954A_low_213
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_213 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 45123283 - 45123577
Alignment:
| Q |
1 |
gtgtaccgggatcaatggagtgtttgactagtctatgtgttgtaaaagtttgcatatagtattattttctagttgttattggacaatgatcatagtttcg |
100 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45123283 |
gtgtatcggggtcaatggagtgtttgactagtctatgtgttgtaaaagtttgcatatagtattattttctagttgtcattggacaatgatcatagtttcg |
45123382 |
T |
 |
| Q |
101 |
tctccgctttttgaagtttccacctatgttgtgattgtgtttctttattttctctatgttgatcttttccaacacaattttgtcttcaactatgaaaaat |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123383 |
tctccgctttttgaagtttctacctatgttgtgattgtgtttctttattttctctatgttgatcttttccaacacaattttgtcttcaactatgaaaaat |
45123482 |
T |
 |
| Q |
201 |
gtttctcaaatgtatccttctatgaatgtctattacagaatattatgaatattagtgatgatgtattgattaaatgtatttttaacggtcttcat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123483 |
gtttctcaaatatatccttctatgaatgtctattacaaaatattatgaatattagtgatgatgtattgattaaatgtatttttaacggtcttcat |
45123577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 22190691 - 22190644
Alignment:
| Q |
40 |
ttgtaaaagtttgcatatagtattattttctagttgttattggacaat |
87 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
22190691 |
ttgtaaaaatttgcatatagtgttattctctagttgtcattggacaat |
22190644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University