View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_224 (Length: 291)
Name: NF10954A_low_224
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_224 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 3 - 283
Target Start/End: Complemental strand, 164331 - 164051
Alignment:
| Q |
3 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164331 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
164232 |
T |
 |
| Q |
103 |
cattgcagtaactgacagtgctatttatataaagcgttctttcgttctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164231 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
164132 |
T |
 |
| Q |
203 |
gcataacaacgaacttgatccatattttttgaacactctcagccatgtctgttgaatctctatccactactgatattcttg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164131 |
gcataacaacgaacttgatccatattttttgaacactctcagccatgtctgttgaatctctatccactactgatattcttg |
164051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University