View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_242 (Length: 285)
Name: NF10954A_low_242
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_242 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 38816583 - 38816319
Alignment:
| Q |
1 |
atgaagtctcggtgctagatatttatgggagatatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816583 |
atgaagtctcggtgctagatatttatgggagatatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatctt |
38816484 |
T |
|
| Q |
101 |
gctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816483 |
gctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaac |
38816384 |
T |
|
| Q |
201 |
cttgttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816383 |
cttgttcttagggttttacattttgtctagattttgcagttggctactttttgtggttacagttg |
38816319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 67 - 216
Target Start/End: Complemental strand, 38821928 - 38821782
Alignment:
| Q |
67 |
tgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtgggtgagaaaggga |
166 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||| |||| | ||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38821928 |
tgttgtgtgtccaggtgaagatttgagcgatcttgctgtggactattcggtgtgcccatctaaagaagaaggaggaaggcttgggtgggtgagaaaggga |
38821829 |
T |
|
| Q |
167 |
caaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttt |
216 |
Q |
| |
|
||||||||| || ||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
38821828 |
caaatggta---tgatgtttagatttgcttaaatcttgttcttagggttt |
38821782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University