View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_251 (Length: 282)
Name: NF10954A_low_251
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_251 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 31718197 - 31718474
Alignment:
| Q |
1 |
ttggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactgatgaccgggaagatcttgatgaagcgggaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718197 |
ttggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactgatgaccgggaagatcttgatgaagcgggaaatt |
31718296 |
T |
 |
| Q |
101 |
cgtgtcaagatgcatcagatgaatgccttaaaagtgaatcgatcgatttccatgtgcctagccaccctcagtatgatattgaacttcaataactctttgg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31718297 |
cgtgtcaatatgcatcagatgaatgccttaagagtga----atcgatttccatgtgcctagccacccccagtatgatattgaacttcaataactctttgg |
31718392 |
T |
 |
| Q |
201 |
tttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttgtggttgccgaagttaaagaaatatgaaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31718393 |
tttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttatggttgccgaagttaaagaaatatgaaa |
31718474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University