View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_253 (Length: 281)
Name: NF10954A_low_253
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_253 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 31658705 - 31658583
Alignment:
| Q |
4 |
tgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658705 |
tgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaat |
31658606 |
T |
|
| Q |
104 |
ttattttcaaagtttggcattgg |
126 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31658605 |
ttattttcaaagtttggcattgg |
31658583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 265
Target Start/End: Complemental strand, 31658558 - 31658521
Alignment:
| Q |
228 |
taatgggagatttatttgatcgtttaacttatgatgtc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtc |
31658521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University