View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_255 (Length: 281)

Name: NF10954A_low_255
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_255
NF10954A_low_255
[»] chr2 (1 HSPs)
chr2 (63-280)||(18147169-18147387)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 63 - 280
Target Start/End: Original strand, 18147169 - 18147387
Alignment:
63 ccttcggtggcatccacctggtggaatgatttgatgtccttggaaggtacggtgggttcaaattggttcaattcataggtgacacgtaaagtgg-taatg 161  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||| |||||    
18147169 ccttcggtggcatccacctggtggaatgatttgatgtccttggagggtacggtgggttcaaattggtttaattcagaggtgacacgtaaagtgggtaatg 18147268  T
162 taatgactacgagtttttgggaagatcagtgggtatctccaaacccttttttgagattttcccttgcctttaccctttatctcttcaaaaggaggcgagg 261  Q
     ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
18147269 gaatgactacgagtttttgggaagatcagtgggtgtctccaaacccttttgtgagattttcccttgactttaccctttatctcttcaaaaggaggcgagg 18147368  T
262 gtaggggatattaggggtg 280  Q
    |||||||||||||||||||    
18147369 gtaggggatattaggggtg 18147387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University