View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_255 (Length: 281)
Name: NF10954A_low_255
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_255 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 63 - 280
Target Start/End: Original strand, 18147169 - 18147387
Alignment:
| Q |
63 |
ccttcggtggcatccacctggtggaatgatttgatgtccttggaaggtacggtgggttcaaattggttcaattcataggtgacacgtaaagtgg-taatg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
18147169 |
ccttcggtggcatccacctggtggaatgatttgatgtccttggagggtacggtgggttcaaattggtttaattcagaggtgacacgtaaagtgggtaatg |
18147268 |
T |
 |
| Q |
162 |
taatgactacgagtttttgggaagatcagtgggtatctccaaacccttttttgagattttcccttgcctttaccctttatctcttcaaaaggaggcgagg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18147269 |
gaatgactacgagtttttgggaagatcagtgggtgtctccaaacccttttgtgagattttcccttgactttaccctttatctcttcaaaaggaggcgagg |
18147368 |
T |
 |
| Q |
262 |
gtaggggatattaggggtg |
280 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18147369 |
gtaggggatattaggggtg |
18147387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University