View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_264 (Length: 277)
Name: NF10954A_low_264
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_264 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 10210825 - 10211095
Alignment:
| Q |
1 |
tcataatgcagtcttcacagatgccaatgagacagtctggaaatgaatgatcatactattatcctttattgattctttgacttggatgtattggatttgg |
100 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| ||||||||||||||||||||| | |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
10210825 |
tcataatgcagtcttcaccgacgccaatgagacagtttggaaatgaatgatcatactactttccttt---gattcttcgacttggatgtattggatttgg |
10210921 |
T |
 |
| Q |
101 |
aataatattttccaatttggatatattggatttggaataatgttttccaatctgggcgtga----caatatatagcagctatgtttatgctggggaaaca |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
10210922 |
aataatgttttccaatttggatatattggatttggaataatgttttccaatctggatgtgacgatcattatatagcagctatgtttatgctgggaaaaca |
10211021 |
T |
 |
| Q |
197 |
tgttgggtactggtccagtttagtgaaaggtatatctgannnnnnnaggtcttctgaagattttattttcttgg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
10211022 |
tgttgggtactggtccagtttagtgaaaggtatatctgatttttttaggtcttcttaagattttatttttttgg |
10211095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University