View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_278 (Length: 270)
Name: NF10954A_low_278
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_278 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 6 - 270
Target Start/End: Complemental strand, 24211105 - 24210841
Alignment:
| Q |
6 |
aaattcaactttggatgagataaagaattggatgaaagagtgggaaccatggatggttatagttaagattttccaacaagttcacactctttgtttcaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211105 |
aaattcaactttggatgagataaagaattggatgaaagagtgggaaccatggatggttatagttaagattttccaacaagttcacactctttgtttcaac |
24211006 |
T |
 |
| Q |
106 |
tatagaacatgttttttggtttgtgaaacattaacatagtaatgtttatctttggctttggaccgttaatctagtttggtgtttgtgggaattatcttga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211005 |
tatagaacatgttttttggtttgtgaaacataaacatagtaatgtttatctttggctttggaccgttaatctagtttggtgtttgtgggaattatcttga |
24210906 |
T |
 |
| Q |
206 |
atagaagaggtaagctagatgtagcgaattggatttagccacgtaatcagagtttatccattgaa |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24210905 |
atagaagaggtaagctagatgtagcgaattggatttagccacgtaatcagagtttatccattgaa |
24210841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University