View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_279 (Length: 270)
Name: NF10954A_low_279
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_279 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 105 - 265
Target Start/End: Original strand, 40758314 - 40758474
Alignment:
| Q |
105 |
taagcattgtgatattattgatgttgaaagaactgttatgctgatgttatttataccgaaagaataatgtatacacaaggaatctattttcaatagattt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758314 |
taagcattgtgatattattgatgttgaaagaattgttatgctgatgttatttatactgaaagaataatgtatacacaaggaatctattttcaatagattt |
40758413 |
T |
 |
| Q |
205 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758414 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
40758474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 40758227 - 40758262
Alignment:
| Q |
18 |
gacatcagacatgagataaatgatcaaaccactgcc |
53 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40758227 |
gacatcagacatgagatgaatgatcaaaccactgcc |
40758262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University