View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_298 (Length: 263)
Name: NF10954A_low_298
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_298 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 442543 - 442297
Alignment:
| Q |
1 |
tcatcacaaatcagaatttacaaagagtcaagcataaatacgaaggtgaaaattgccatacctgataataatgctaagagcaccaagcggagtgaccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442543 |
tcatcacaaatcagaatttacaaagagtcaagcataaatacgaaggttaaaattgccatacctgataataatgctaagagcaccaagcggagtgaccaat |
442444 |
T |
|
| Q |
101 |
atagctggagcaaatgcatatgctgcaaaattagcaatctcaccgacaatcactgttgaaaaaagcaaatgttagaattgaaactttaatccatttgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442443 |
atagctggagcaaatgcatatgctgcaaaattggcaatctcaccgacaatcactgttga-aaaagcaaatgttagaattgaaactttaatccatttgctg |
442345 |
T |
|
| Q |
201 |
gtatcaataactgtgtgcaactcagatcaataagttgtacgtagatat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442344 |
gtatcaataactgtgtgcaactcagatcaataagttgtacgtagatat |
442297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University