View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_301 (Length: 262)
Name: NF10954A_low_301
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_301 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 50244693 - 50244442
Alignment:
| Q |
6 |
agaagcacagagaaacacattctcttctgttacggcagcggaaagaacacgaggaaatccaacatatagtgactcacaagacctcagttcatgtgatatc |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50244693 |
agaagcacagagcaacacattctcttctgttacggcagcggaaagaacacgaggaaatccaacatatagtgactcacaagacctcagttcatgtgatatc |
50244594 |
T |
|
| Q |
106 |
tttgatggctcttggattcaagatgattctcatgaacctgtttatcagcatgattcatgttcttttcttgatgatacttttaactgtttcaagaatggac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50244593 |
tttgatggctcttggattcaagatgattctcatgaaactgtttatcaacatggttcatgtccttttcttgatgatacttttaactgtttcaagaatggac |
50244494 |
T |
|
| Q |
206 |
gttcagattttgagtttcttaaatatcgttggaagccacatggttgtcaaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50244493 |
gttcagattttgagtttcttaaatatcgttggaagccacatggttgtcaaat |
50244442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 53443008 - 53442962
Alignment:
| Q |
22 |
acattctcttctgttacggcagcggaaagaacacgaggaaatccaac |
68 |
Q |
| |
|
||||||||||||||||| | ||| |||||| |||||||||||||||| |
|
|
| T |
53443008 |
acattctcttctgttacagtagcagaaagagcacgaggaaatccaac |
53442962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 43001417 - 43001371
Alignment:
| Q |
22 |
acattctcttctgttacggcagcggaaagaacacgaggaaatccaac |
68 |
Q |
| |
|
||||||||||||||||| | ||| |||||| |||||||||||||||| |
|
|
| T |
43001417 |
acattctcttctgttacagtagcagaaagagcacgaggaaatccaac |
43001371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University