View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_305 (Length: 260)
Name: NF10954A_low_305
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_305 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 77 - 244
Target Start/End: Complemental strand, 35657880 - 35657713
Alignment:
| Q |
77 |
caccaatgcattatatcttgcccttttattcaagcttttcaactatcagtgcaatatatcttgccctcttattcaagctttgacgatcttgtgtttttca |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35657880 |
caccaatgcattatatcttgcccttttattcaagcttttcaactatcaatgcaatatatcttgccctcttattcaagctttgacgatcttgtgtttttca |
35657781 |
T |
 |
| Q |
177 |
ggttttttgttatcattgggcatctattttgcaagtttttggcttcgttctccacggtgttctatatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35657780 |
ggttttttgttatcattgggcatctattttgcaagtttttggcttcgttctccacggtgttctatatt |
35657713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University