View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_307 (Length: 259)
Name: NF10954A_low_307
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_307 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 33 - 259
Target Start/End: Complemental strand, 48484615 - 48484389
Alignment:
| Q |
33 |
tatagtcctgtagtgttgtgtgtaccgtgtcttcatatctccataatacttctgcgcttctttctcatttttgaaataacaaaacaaatttcttcagatc |
132 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484615 |
tatagtcctgcagtgttgtgtgtaccgtgtcttcatatctccataatatttctgcgcttctttctcatttttgaaataacaaaacaaatttcttcagatc |
48484516 |
T |
|
| Q |
133 |
acggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttcatatgaacttttaca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484515 |
acggaacacaatccccaagctggaattcccatgaagttaaatcagaaacaggtgttttcctttttgcaaggtaagcatgcatttcatatgaacttttaca |
48484416 |
T |
|
| Q |
233 |
tactgaaacttccatttcttgtacatg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48484415 |
tactgaaacttccatttcttgtacatg |
48484389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University