View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_316 (Length: 258)
Name: NF10954A_low_316
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_316 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39932771 - 39932532
Alignment:
| Q |
1 |
tcgattcataacttttcaaacacatgtttatttgaactccctttacctgtaggaatatgtcttggatatgtcgattgtgttatgggcggagtcctattca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39932771 |
tcgattcataacttttcaaacacatatttattcgaactccctttacctgtaggaatacgtcttggatatgtcgatcgtgttacgggcggagtcctattca |
39932672 |
T |
|
| Q |
101 |
tggggacatggtagaattgagagaagttgtaggtattatgtcgagtctcttgttgcccctgttaaggaacttgtcttcactcgagagatgcaacaattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39932671 |
tggggacatggtagaattgagagaagttgtaggtattatgtcgagtctcttgttgcccctgttaaggaacttgtcttcactcgagaaatgcaacaattaa |
39932572 |
T |
|
| Q |
201 |
gataaatgtgtcttgatttgaaaatattttctcaatgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39932571 |
gataaatgtgtcttgatttgaaaatattttcttaatgcat |
39932532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 18148822 - 18148679
Alignment:
| Q |
1 |
tcgattcataacttttcaaacaca-----tgtttatttgaactccctttacctgtaggaatatgtcttggatatgtcgattgtgttatgggcggagtcct |
95 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| |||| ||||||||||||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
18148822 |
tcgattcataacttttcaaacacaaccaatatttattcgaaccccctttacctgtaggaatacgtcttggatctgccgattgtgttatgggcggagtcct |
18148723 |
T |
|
| Q |
96 |
attcatggggacatggtagaattgagagaagttgtaggtattat |
139 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
18148722 |
attcatggggacctggtagaattgggagaagctgtaggtattat |
18148679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 72 - 118
Target Start/End: Original strand, 49069066 - 49069112
Alignment:
| Q |
72 |
cgattgtgttatgggcggagtcctattcatggggacatggtagaatt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49069066 |
cgattatgttatgggcggagtcctattcatggggacctggtagaatt |
49069112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University