View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_320 (Length: 257)

Name: NF10954A_low_320
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_320
NF10954A_low_320
[»] chr4 (1 HSPs)
chr4 (24-216)||(2442696-2442888)
[»] chr1 (1 HSPs)
chr1 (61-193)||(50984196-50984328)
[»] scaffold0649 (1 HSPs)
scaffold0649 (213-257)||(2121-2165)
[»] chr8 (1 HSPs)
chr8 (37-73)||(34019916-34019952)
[»] chr2 (1 HSPs)
chr2 (220-257)||(15814856-15814893)
[»] chr6 (1 HSPs)
chr6 (213-254)||(11384905-11384946)
[»] chr5 (1 HSPs)
chr5 (213-254)||(21794389-21794430)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 24 - 216
Target Start/End: Original strand, 2442696 - 2442888
Alignment:
24 gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcatgcgatagaatgatacaaaatttccagaattgcattgtaaaatggt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  | || |  |||||||||||||    
2442696 gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcgtgcgatagaatgatacaaaatttgtataaattgattgtaaaatggt 2442795  T
124 aatatagaggagccctcgatcaatttctggtaaacagtgtcagtgagatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatat 216  Q
    |||||| || |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||    
2442796 aatataaagaagccctcgatcaatttctggtaaacagtgttagtgtgatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatat 2442888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 61 - 193
Target Start/End: Complemental strand, 50984328 - 50984196
Alignment:
61 gactatcttgctctgcatgcgatagaatgatacaaaatttccagaattgcattgtaaaatggtaatatagaggagccctcgatcaatttctggtaa--ac 158  Q
    ||||||||||||||||||| || ||| | | |||||||||  ||||||| |||| ||||||||||||||||| ||||||| |||||||||| | ||  ||    
50984328 gactatcttgctctgcatgtgacagattaaaacaaaatttgtagaattg-attg-aaaatggtaatatagagaagccctcaatcaatttctagaaaacac 50984231  T
159 agtgtcagtgagatgaacttgaaacaaaaacaagg 193  Q
    ||| ||||||||||||| ||||||||||| |||||    
50984230 agtttcagtgagatgaagttgaaacaaaatcaagg 50984196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0649 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0649
Description:

Target: scaffold0649; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 213 - 257
Target Start/End: Original strand, 2121 - 2165
Alignment:
213 atatccttccacatcacttaatcccttgtcccccagaacacttga 257  Q
    |||| |||||||||||||||||||||||||||||| |||||||||    
2121 atattcttccacatcacttaatcccttgtcccccataacacttga 2165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 37 - 73
Target Start/End: Complemental strand, 34019952 - 34019916
Alignment:
37 cttctctttttgcaaccattttcagactatcttgctc 73  Q
    |||||||||||||||||||||||||||||||||||||    
34019952 cttctctttttgcaaccattttcagactatcttgctc 34019916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 257
Target Start/End: Original strand, 15814856 - 15814893
Alignment:
220 tccacatcacttaatcccttgtcccccagaacacttga 257  Q
    |||||||||||||||||||||||||||| |||||||||    
15814856 tccacatcacttaatcccttgtcccccacaacacttga 15814893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 11384946 - 11384905
Alignment:
213 atatccttccacatcacttaatcccttgtcccccagaacact 254  Q
    |||| |||||||||||||||||||||| ||||||| ||||||    
11384946 atattcttccacatcacttaatcccttctcccccacaacact 11384905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 254
Target Start/End: Original strand, 21794389 - 21794430
Alignment:
213 atatccttccacatcacttaatcccttgtcccccagaacact 254  Q
    |||| |||||||||||||||||||||| ||||||| ||||||    
21794389 atattcttccacatcacttaatcccttctcccccacaacact 21794430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University