View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_332 (Length: 254)
Name: NF10954A_low_332
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_332 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 11565499 - 11565736
Alignment:
| Q |
10 |
atgcaagtgcactacaaattgttggaattaaacacttgtttcttctttactcaatcagttatcaatacctattatctatccattcacgtgaaacacaact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565499 |
atgcaagtgcactacaaattgttggaattaaacacttgtttcttctttactcaatcagttatcaatacctattatctatccattcacgtgaaacacaact |
11565598 |
T |
|
| Q |
110 |
tcttcgacgaacccgaactaccacaacgcagttaatcctctgttccccataactcaccacaatctgcgccatttccgtcgttcatgtctatgcaccattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565599 |
tcttcgacgaacccgaactaccacaacgcagttaatcctctgttccccattactcaccacaatctgcgccatttccgtcgttcatgtctatgcaccattt |
11565698 |
T |
|
| Q |
210 |
cccaccctcgatctaatctctatccgttcatttcactc |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11565699 |
cccaccctcgatctaatatctatccgttcatttcactc |
11565736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University