View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_346 (Length: 251)
Name: NF10954A_low_346
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_346 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 24125520 - 24125286
Alignment:
| Q |
17 |
tgctctctatgggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttccgttgaagnnnnnnntcatacatcatgtacctattacg |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
24125520 |
tgctctctataggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttccgttgaagaaaaaaatcatacatcatgtacctattatg |
24125421 |
T |
|
| Q |
117 |
agtggaaattggccttgattttatattggagctaatagagtagggcgatggggggtgagtctaggtcagactatctctggaaacaaggacctagtttttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24125420 |
agtggaaattggccttgattttatattggagctaatagagtagggcgatggggggtgagtctaggtcagactatccctggaaacaaggacctagtttttg |
24125321 |
T |
|
| Q |
217 |
tcacccccacctgagagtgttcacttttcttattt |
251 |
Q |
| |
|
||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
24125320 |
tcaaccccacccgggagtgttcacttttcttattt |
24125286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 45163235 - 45163287
Alignment:
| Q |
26 |
tgggacacatgtggaatcaactttccacttgtttttctttctgaaaatggttcc |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45163235 |
tgggacacatgtg-aatcaactttccacttgttcttctttctgaaaatggttcc |
45163287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University