View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_347 (Length: 251)
Name: NF10954A_low_347
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_347 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 6111332 - 6111573
Alignment:
| Q |
1 |
aagtgcaaccgagtgaacatcaatatcaattgaaacatgcagagctactcctggcttaaaatcatgtgtatcactgccaaaa-atattgacatggctaga |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6111332 |
aagtgcaaccgagtgaatatcaatatcaattgaaacatgcagagctactcctggcttaaaatcatgtgtatcactgccaaaaaatattgacatggctaga |
6111431 |
T |
 |
| Q |
100 |
ttttcagccaaagcatggaactagagctccacaacctatgcttcgaagatgctactctcagacccttgttcaagaagtgaagctttaggcagctcttgcc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111432 |
ttttcagccaaagcatggaactagagctccacaacctatgcttcgaagatgctactcttagacccttgttcaagaagtgaagctttaggcagctcttgcc |
6111531 |
T |
 |
| Q |
200 |
tcattgtttggacagaagaaagaattaccagcgttcatctca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6111532 |
tcattgtttggacagaagaaagaattaccagcgttgatctca |
6111573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University