View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_353 (Length: 250)
Name: NF10954A_low_353
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_353 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 9867845 - 9868088
Alignment:
| Q |
1 |
gtggtgtgcctgtagtagcgatcgtagtggtaattggatcacactgtctagaaaagttttattcacgtggaatttagtcatgcatggctaaacaaatatg |
100 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9867845 |
gtggtttgcctttagtagcgatcgtagtggtaattggatcacaccatctagaaaagttttattaacgtggaatttagtcatgcatggctaaacaaatatg |
9867944 |
T |
|
| Q |
101 |
actcaatcatcatattcacgatgcatgacgaaatcatgatcaaagagagactggcgtcgcttctttatatttcaccaatgttccaaagcaatttttgtat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9867945 |
attcaatcatcatattcacgatgcatggcgaaatcatgatcaaagagagactggcgtcgcttccttatatttcaccaatgttccaaagcaatttttgtat |
9868044 |
T |
|
| Q |
201 |
gttgaattaaggatagggtttgatgtgtgtggtatattattcga |
244 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9868045 |
gttgaattaaggaaagggtttgatgtgtgtggtatattgttcga |
9868088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University