View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_356 (Length: 250)
Name: NF10954A_low_356
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_356 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 23 - 250
Target Start/End: Complemental strand, 37428191 - 37427966
Alignment:
| Q |
23 |
tgagttttttgagtaggaagtgtacttctccatttcattattaactgtgggttggtttcctacgtgtacagatgtaaaatgtttctttcctttattatat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37428191 |
tgagttttttgagtaggaagtgtacttctccatttcattattaactgtgggttggtttcctacgtgtacagatgtaaaatgtttctttcctttattatat |
37428092 |
T |
|
| Q |
123 |
attgttgaaatgtggcttggtttaacatatcttataaactcttctattattgaacttgannnnnnnngtgtgtgtttaggggcgttcttcatgcaactct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37428091 |
attgttgaaatgtggcttggtttaacatatcttataatctcttctattattgaacttgattttttt--tgtgtgtttaggggcgttcttcatgcaactct |
37427994 |
T |
|
| Q |
223 |
ggcaaaggcaagagcagtcagtcgccgg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37427993 |
ggcaaaggcaagagcagtcagtcgccgg |
37427966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University