View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_371 (Length: 250)
Name: NF10954A_low_371
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_371 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 30523011 - 30523230
Alignment:
| Q |
10 |
gtatccatgcttcataatctctaacaaatgcccattagacacttaagtataatcactttgttaaagacatggttcatgtataatttcatttcattttgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523011 |
gtatccatgcttcataatctctaacaaatgcccattagacacttaagtctaatcactttgttaaagacatggttcatgtataatttcatttcattttgat |
30523110 |
T |
|
| Q |
110 |
aatgcaaattgatttcttagctgctccaatactaaatcaatttagctataaactagcatgtctaatgttaattataatgtgatgatattatatgcttata |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30523111 |
aatgcaaattgatttcttagctgctccaatactaaatcaatttagctataagctagcatgtctaatgttaattataatgtgatgatattatatgcttata |
30523210 |
T |
|
| Q |
210 |
acaacatctaagctttgaaa |
229 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
30523211 |
acaacatctaaactttgaaa |
30523230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University