View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_381 (Length: 249)
Name: NF10954A_low_381
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_381 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 28 - 240
Target Start/End: Original strand, 43408163 - 43408375
Alignment:
| Q |
28 |
gatggtggattgggcctagggcaaatccaggtccaacgacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactc |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408163 |
gatggtggattgggcctagggcaaatccaggtccaacaacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactc |
43408262 |
T |
 |
| Q |
128 |
atccaacaacgtccttattcagatatgggtacctatgaggaggagatcagccctaattcacactcaaaaccactaccttcagcaggagtcatcatctgca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408263 |
atccaacaacgtccttattcagatatgggtacctatgaggaggagatcagccctaattcacactcaaaaccactaccttcagcaggagtcatcatctgca |
43408362 |
T |
 |
| Q |
228 |
cctgtttctgtga |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43408363 |
cctgtttctgtga |
43408375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University