View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_383 (Length: 249)
Name: NF10954A_low_383
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_383 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 42039413 - 42039635
Alignment:
| Q |
15 |
catgatgttgagataagcactctatatcctggtgaatcattcaggagcttggaggattgctttgagagctttgttgccatggcggccgacaagattcata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039413 |
catgatgttgagataagcactctatatcctggtgaatcattcaggagcttggaggattgctttgagagctttgttgccatggcggccgacaagattcata |
42039512 |
T |
 |
| Q |
115 |
aaggagaaaatggagttaccggcggcacgaaggctttagtagaaccagtgccaatcacagcttcctgttgaagagtttcacctcagaaaccgtcctaggt |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42039513 |
aaggagaaaatggagttaccggtggcacgaaggctttagtagaaccagtgccaatcacagcttcctgttgaagagtttcacctcaaaaaccgtcctaggt |
42039612 |
T |
 |
| Q |
215 |
tattctttattgaggtggatatt |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42039613 |
tattctttattgaggtggatatt |
42039635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University