View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_384 (Length: 249)
Name: NF10954A_low_384
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_384 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 115171 - 115381
Alignment:
| Q |
24 |
aggatttcatagctcaattggtttgagctaagtcagctaacgggttgaagaagttgggggaattaatagaccgaggttcaaaccctggtgaaggagaaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115171 |
aggatttcatagctcaattggtttgagctaagtcagctaacgggttgaagaagttgggggaattaatagaccgaggttcaaaccctggtgaaggagaaaa |
115270 |
T |
 |
| Q |
124 |
tagtaatgtaaaaactaattcactagcattttcagatcaaaagaaaacagataaataatttatgtcaatcaccgattcaccattctaaatcatttgacag |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115271 |
tagtaatgtaaaaactaattcactaggatttgcagatcaaaagaaaacagataaataatttatgtcaatcaccgattcaccattctaaatcatttgacag |
115370 |
T |
 |
| Q |
224 |
gacacggtaat |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
115371 |
gacacggtaat |
115381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University