View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_391 (Length: 248)
Name: NF10954A_low_391
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_391 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 3271968 - 3271724
Alignment:
| Q |
1 |
atcatattagattctttgtctcacagctcagcatagcgttttgtgtttgtttttaacatttgttccatgcattcactgtttgtccaaatggtagaacatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
3271968 |
atcatattagattctttgtctcacagctcagcatagcgttttgtgtttgtttttaacatttgttccatgtattcaccgtttgtccaaatgttagaacatc |
3271869 |
T |
 |
| Q |
101 |
tgcttaaattcaatgtcttaaacaattgtctctatgtgattgaagagtatatattgatcattcacagaggtccagattggatttcaataccattacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3271868 |
tgcttaaattcaatgtcttaaacaattgtctctatgtgatggaagagtatatattgatcattcacagagctccagattggatttcaataccattacaaat |
3271769 |
T |
 |
| Q |
201 |
tgaatatgataccataaatgatagtaataaactattcatatcagt |
245 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
3271768 |
tgaataggataccataaatgatagtaatgaactattcatgtcagt |
3271724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University