View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_393 (Length: 248)
Name: NF10954A_low_393
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_393 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 25014551 - 25014792
Alignment:
| Q |
1 |
aatagcaatggaagcaaatggcataacaatgccaatagcagcattagtgaattcacatctgcttgtctctgcaatatttaacacttaacattagcattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25014551 |
aatagcaatggaagcaaatggcataacaatgccaaaagcagcattagtgaattcacgtctgcttgtctctgcaaaatttaacacttaacattagcattat |
25014650 |
T |
|
| Q |
101 |
tccacaatagagaaattaaagaaccnnnnnnntttcactcattaggttaaaccgcggaatttgaaaaagacctgcaactacaatttaggccgcaatatca |
200 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25014651 |
tccactatagagaaattaaagaactaaaaaaatttcactcattaggttaaaccgcggaatttgaaaaagacctgcaactgcaatttaggccgcaatatca |
25014750 |
T |
|
| Q |
201 |
atannnnnnnnaatattgaatcctggttatctgaactccaaa |
242 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||| |
|
|
| T |
25014751 |
atattttttttaatattgaatcctggttatccgaactccaaa |
25014792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University