View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_399 (Length: 247)
Name: NF10954A_low_399
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_399 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 3 - 247
Target Start/End: Original strand, 38322595 - 38322839
Alignment:
| Q |
3 |
ctccaagaatatgtgttagccataaagtacaaccctgattggcaaaaagtgcaggttcatttttctatactaaatggtcaatgtaatcatatttatgaac |
102 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38322595 |
ctccaacaaaatgtgttagccataaagtacaaccctgattggcaaaaagtgcaggttcatttttctatactatatggtcaatgtaatcatatttatgaac |
38322694 |
T |
|
| Q |
103 |
ttatgatcttattaattaatagtagcaaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtgatgctcaaata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38322695 |
ttatgatcttattaattaatagtagcaaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtaatgctcaaata |
38322794 |
T |
|
| Q |
203 |
aatgcctcaatttcagaatctaaagtccatccttcagagattgaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322795 |
aatgcctcaatttcagaatctaaagtccatccttcagagattgaa |
38322839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University