View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_419 (Length: 246)
Name: NF10954A_low_419
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_419 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 4083112 - 4082873
Alignment:
| Q |
7 |
tttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgcgaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4083112 |
tttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgctaat |
4083013 |
T |
|
| Q |
107 |
cctattagggagaatgaaaaatatagaaatggacctatcactgaattctttgcattgtcatagggcaatcttcttcccatgacaaaagatattatatatg |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| | | |||| || |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4083012 |
cctattagggagaatgaaaaatttagaaatggacctattaataaattgttggcattgtcatagggcaatcttcttcccatgacaaaagatattatcgatg |
4082913 |
T |
|
| Q |
207 |
taggggatttcatttgctgacaatttgttctatgtccttt |
246 |
Q |
| |
|
|| | |||||| |||||||||||||||||||||| |||| |
|
|
| T |
4082912 |
taagtgatttctattgctgacaatttgttctatgttcttt |
4082873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
| Q |
51 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
94 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
48203029 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
48203072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University