View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_423 (Length: 246)
Name: NF10954A_low_423
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_423 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 32836861 - 32836643
Alignment:
| Q |
17 |
acatccagtgtgttggcaagtctgctcgagactgaagcgattggagaagctcttgctatactggaagaattgtcgaaccattggtccgataaagcgaaca |
116 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32836861 |
acatgcagtgtgttggcaagtctgctagagactgaagcgattggagaagctcttgctatactggaagaattgtcgaaccattggtccgataaagcgaaca |
32836762 |
T |
 |
| Q |
117 |
ttgcagcttccaatgcactgacttctattttaaagatccttgattctggtaaccaagagtaccaacggaaagctattagaataatgtgcaatttttcatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32836761 |
ttgcagcttccaatgcactgacttctattttaaagatccttgattctggtaaccaagagtaccaacggaaagctattagaataatgtgcaatttttcatc |
32836662 |
T |
 |
| Q |
217 |
caattctgaatattgttcg |
235 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
32836661 |
caattctgaattttgttcg |
32836643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University