View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10954A_low_447 (Length: 243)
Name: NF10954A_low_447
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10954A_low_447 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 43238834 - 43239059
Alignment:
| Q |
20 |
atatgtgtaccaaa-tcttgcgtttttggaaattggaatgagttaacatattcaccatggaggttgaaggtagagcaagcaatgataactctctcactct |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43238834 |
atatgtgtaccaaactcttgcgtttttggaaattggaatgagttaacatattcaccatggaggttgaaggtagagcaagcaatgataactctctcactct |
43238933 |
T |
|
| Q |
119 |
caacctagaacatggtcaagaagacaagaatatctcaaatgattcttatgatctttccactgctcatactattgacaaaggtatattactc-tattctca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43238934 |
caacctagaacatggtcaagaagacaagaatatctcaaatgattcttatgacctttccactgctcatactattgacaaaggtatattactcttattctca |
43239033 |
T |
|
| Q |
218 |
gttaaattatgttttaacttttatgt |
243 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
43239034 |
gctaaattatgttttaacttttatgt |
43239059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University